Piltdown Man Hoax

     Piltdown was an archaeological dig site in England.  In 1908 and 1912 human, ape and other mammalian fossil remains were found by Charles Dawson.  In 1913 at a nearby dig site they found a canine tooth that was filed down to a humans tooth.  British paleoanthropologists came to the conclusion that it came from a single organism.  Then in 1953 Piltdown man was considered to be a hoax because the skull was modern and the tooth that was found was from an ape that was filed down. It was proven to be a hoax because of conflicting body evidence and evidence of fraud.  The hoax of piltdown man could be argued that it had a sobering effect on the scientific community.
     Human faults in Piltdown man was human emotions such as Charles Dawson's ambitions.  He was caught up in the moment of this archaeological discovery that some may say he jumped the gun.  Immediately he named it the first English man.  Scientists were baffled at the fact that the first "English Man" decided to live in England which contradicted with evolution and led scientists astray.
     Specific tools that helped in the process of proving that Piltdown man was a hoax is being capable of measuring fluoride within the fossils and this process was introduced around 1949.  In 1953 they found out that the skull was about 100 years old and under a microscope they found that the tooth originated from an ape, but it was filed down to make it look like a human tooth. Removal of "human" factors from science is possible, but it wont ensure the safety of permanently removing scandals.  As humans we make mistakes, but we eventually learn from them.  Removing the human factors from science in my opinion wouldn't make sense because we wouldn't further our explanations of whats true and false.
     As for the life lesson goes I would have to say that don't let personal beliefs or pride/patriotism get in the way of work.  Piltdown man is a great example because scientist are supposed to neutral, they're not supposed to lean a little to the left nor the right.
     
 

Comparative Primates

  

  

1.  Lemurs
a. Live in trees which is why they are also called arboreal. Some species of Lemurs though that also spend time on the ground. They are only found on the Comoro Islands and Madagascar Islands. This is off of the Southeast coast of Africa.

b. Lemurs lack in sexual dimorphism in size, yet they show it in sexual dichromatic which is a differentiation through color of their fur.

c. Lemurs can vary in size from the Mouse Lemur which weighs in about 1 oz. and its body ranges from 4.5-5.5" with a 6" tail to the size of Lemur who has long been extinct which weighed in about 450 lbs. Lemurs share little in common to other primates.

2. Spider Monkey
a.  Spider Monkey live in the tropics of of South and Central America from South Mexico to Brazil.

b.Their sizes range from 14 in. - 26 in. and weigh in about 13.3 lbs. As for their differences the males and female look almost the same considering the fact they have no competition amongst each other for mating.

c. Female Spider Monkey's played a bigger role than males such as when there are intruder they would make loud noises to scare off intruders.

3. Baboon

 a. Baboons generally live in savannas, semi-arid habitats and some live in the tropics.

b.  The Baboon size ranges from 20-40 in. and weigh from 30-80 lbs. their difference are quite visible such. The male has a silver or white mane with a somewhat tan-red face. While the females are brown in color. 

c. Baboons live in groups in a size about 50 or so consisting of 7-8 males and approximately twice as many females plus their young. They have a ranking system such certain females being leaders and they don't seem to have territorial borders, but they overlap. 

4. Gibbon

a. Gibbons can be found in Southeast Asia from Burman, Sumatra, China, to the Malay Peninsula. 

b. Their size is fairly small which allows them to freely feed while in trees. They can weigh from 13-25 lbs. Differences in males and females is that males have black fur while females have a gold/reddish fur.

c. Gibbons live on branches. In the morning adult female Gibbons use hooting sound for territorial purposes that last around 20 minutes. 

 

5. Chimpanzee 

a. They are found in the African rain forests and in the savanna. 

b. Males range from 3-4 ft. and weigh in about 150 lbs. while females range from 2-3 ft. tall and weigh in about 100lbs. Their differences can't be seen through their color, but through their sizes. 

c. Their groups range from 3-6 individuals. They use gestures to indicate emotions i.e. sign language. 

 

Analogy/Homology Blog Post

1a. Two different species with the same homologous trait are Humans and Primates.
1b. The front limbs of a human and a primate are homologous and they both end in five digits even though their sizes may differ they both function the same.
1c. Darwinius masillae aka Ida was a common ancestor for humans and primates.  It has the same characteristics as prosimians such as lemurs, but its closely related to humans.
1d.

2a. Birds and insects have analogous structures such as their wings. They serve the same function, but come from different origins.
2b. The wings of birds and insects serve the same function such as flying, but insects have evolved separately whereas the birds are essentially modern day dinosaurs.
2d.

DNA Code

ATTGTACCAAGATCTCCCATGCAATATACTACTGGCCG