Human Variation & Race

1.  At high altitudes our blood isn't capable of absorbing oxygen; we preform best at sea level.

2. The human body adapts to what is effectively oxygen deprivation by initially increasing heart rate, breathing rate, then the number of hemoglobin, then density of capillaries.
Short Term: Increased breathing rate
 
 Facultative: Exercise

Developmental: Body adapts

Cultural: Sherpa Family


3.  Benefits of studying human variations is to prepare one self to what's to come.  Info. from explorations can be used for experiments.  It can be used in a productive way such as training.

4. The inhabitants of the Himalayan mountains is a good example of their adaptations to the high altitudes of the the Himalayas.  Such as the Sherpa who inhabit the Himalayas have genetic adaptations to high altitudes.  Over generations of inbreeding showed a predominance of high-altitude genes that exist in some peoples in Asia and a set of low-altitude genes that exist in other groups of Asians.
 

Language Blog

Part one of the experiment was quite difficult at first because it felt like playing charades.  I asked my sister to help me with this assignment and she had a very difficult time trying to figure out what I was trying to say.  After a couple of minutes I began to point things out and each time she got it wrong I would shake my head saying no or yes.  My sister had the advantage in communicating complex ideas.  The culture that uses symbolic language would obviously get irritated because my sister was getting irritated.  Individuals in our culture such as foreign exchange students would have a terrible time speaking.  When I was in middle school I met some girl that originated from Japan and she couldn't speak any English and her only way of communicating was through her small computer which she would type what she wanted to say. 

Part two of the experiment was very hard for me and I can understand the frustration my sister went through.  We didn't get to finish the 15 minutes (ended at13:50) because it was a daunting task for me because we kept having to restart.  I'd catch myself raising my arm, etc... and we would start over from there.  In a sense I enjoyed messing around with my sister because she had little to no patients to these sort of things.  The use of signs in language is very important because there are certain things that words can't describe.  Reading body language is very difficult and it's so difficult that there are class for reading body language.  The benefit to having the ability to read ones body language is the fact that you can determine their emotion.  The only time when reading ones body language wouldn't benefit you is if you were in the middle of an ocean during a storm.

Piltdown Man Hoax

     Piltdown was an archaeological dig site in England.  In 1908 and 1912 human, ape and other mammalian fossil remains were found by Charles Dawson.  In 1913 at a nearby dig site they found a canine tooth that was filed down to a humans tooth.  British paleoanthropologists came to the conclusion that it came from a single organism.  Then in 1953 Piltdown man was considered to be a hoax because the skull was modern and the tooth that was found was from an ape that was filed down. It was proven to be a hoax because of conflicting body evidence and evidence of fraud.  The hoax of piltdown man could be argued that it had a sobering effect on the scientific community.
     Human faults in Piltdown man was human emotions such as Charles Dawson's ambitions.  He was caught up in the moment of this archaeological discovery that some may say he jumped the gun.  Immediately he named it the first English man.  Scientists were baffled at the fact that the first "English Man" decided to live in England which contradicted with evolution and led scientists astray.
     Specific tools that helped in the process of proving that Piltdown man was a hoax is being capable of measuring fluoride within the fossils and this process was introduced around 1949.  In 1953 they found out that the skull was about 100 years old and under a microscope they found that the tooth originated from an ape, but it was filed down to make it look like a human tooth. Removal of "human" factors from science is possible, but it wont ensure the safety of permanently removing scandals.  As humans we make mistakes, but we eventually learn from them.  Removing the human factors from science in my opinion wouldn't make sense because we wouldn't further our explanations of whats true and false.
     As for the life lesson goes I would have to say that don't let personal beliefs or pride/patriotism get in the way of work.  Piltdown man is a great example because scientist are supposed to neutral, they're not supposed to lean a little to the left nor the right.
     
 

Comparative Primates

  

  

1.  Lemurs
a. Live in trees which is why they are also called arboreal. Some species of Lemurs though that also spend time on the ground. They are only found on the Comoro Islands and Madagascar Islands. This is off of the Southeast coast of Africa.

b. Lemurs lack in sexual dimorphism in size, yet they show it in sexual dichromatic which is a differentiation through color of their fur.

c. Lemurs can vary in size from the Mouse Lemur which weighs in about 1 oz. and its body ranges from 4.5-5.5" with a 6" tail to the size of Lemur who has long been extinct which weighed in about 450 lbs. Lemurs share little in common to other primates.

2. Spider Monkey
a.  Spider Monkey live in the tropics of of South and Central America from South Mexico to Brazil.

b.Their sizes range from 14 in. - 26 in. and weigh in about 13.3 lbs. As for their differences the males and female look almost the same considering the fact they have no competition amongst each other for mating.

c. Female Spider Monkey's played a bigger role than males such as when there are intruder they would make loud noises to scare off intruders.

3. Baboon

 a. Baboons generally live in savannas, semi-arid habitats and some live in the tropics.

b.  The Baboon size ranges from 20-40 in. and weigh from 30-80 lbs. their difference are quite visible such. The male has a silver or white mane with a somewhat tan-red face. While the females are brown in color. 

c. Baboons live in groups in a size about 50 or so consisting of 7-8 males and approximately twice as many females plus their young. They have a ranking system such certain females being leaders and they don't seem to have territorial borders, but they overlap. 

4. Gibbon

a. Gibbons can be found in Southeast Asia from Burman, Sumatra, China, to the Malay Peninsula. 

b. Their size is fairly small which allows them to freely feed while in trees. They can weigh from 13-25 lbs. Differences in males and females is that males have black fur while females have a gold/reddish fur.

c. Gibbons live on branches. In the morning adult female Gibbons use hooting sound for territorial purposes that last around 20 minutes. 

 

5. Chimpanzee 

a. They are found in the African rain forests and in the savanna. 

b. Males range from 3-4 ft. and weigh in about 150 lbs. while females range from 2-3 ft. tall and weigh in about 100lbs. Their differences can't be seen through their color, but through their sizes. 

c. Their groups range from 3-6 individuals. They use gestures to indicate emotions i.e. sign language. 

 

Analogy/Homology Blog Post

1a. Two different species with the same homologous trait are Humans and Primates.
1b. The front limbs of a human and a primate are homologous and they both end in five digits even though their sizes may differ they both function the same.
1c. Darwinius masillae aka Ida was a common ancestor for humans and primates.  It has the same characteristics as prosimians such as lemurs, but its closely related to humans.
1d.

2a. Birds and insects have analogous structures such as their wings. They serve the same function, but come from different origins.
2b. The wings of birds and insects serve the same function such as flying, but insects have evolved separately whereas the birds are essentially modern day dinosaurs.
2d.

DNA Code

ATTGTACCAAGATCTCCCATGCAATATACTACTGGCCG

1.  In my opinion I would have to say that Jean-Baptiste Lamarck had a positive influence over Darwin mainly because they both agreed on the basis that life gradually changed over time and continued to change, living things continued to increase their chances of survival through adaptation, and they both believed that life came from simpler organisms thus turning to complex organisms.

2.  In 1801 Lamarck began to publish his detail on the evolutionary theories.  He is known for his Theory of Inheritance of Acquired Characteristics which practically says that living things adapt to their environment thus passing it down to their future generations. (http://www.ucmp.berkeley.edu/history/lamarck.html)

3.  The bullet point "In order for traits to evolve and change, they MUST be heritable" affects Lamarck's work because in his work he uses examples such as elephants previously having short trunks, but after time they adapted to have have longer trunks and of course that was through a long process of generations and generations of adaptation.

4.  Darwin could have developed his ideas without Lamarck just because there were plenty of other people who had the same idea or were on the same path.

5.  The attitude of the church toward Darwin's book On the Origin of Species actually angered the church and the old Natural theologians responded very negatively toward it.